View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18127_low_38 (Length: 244)

Name: NF18127_low_38
Description: NF18127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18127_low_38
NF18127_low_38
[»] chr5 (3 HSPs)
chr5 (76-228)||(38744279-38744435)
chr5 (84-129)||(38782022-38782067)
chr5 (84-126)||(38788098-38788140)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 76 - 228
Target Start/End: Original strand, 38744279 - 38744435
Alignment:
76 gaagaagccatttaccttatatcattaataattcagttttgaataaaagctgattannnnnnn----acgtatagccnnnnnnnnattgttaacagaccg 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||        |||||||||||||||    
38744279 gaagaagccatttaccttatatcattaataattcagttttgaataaaagctgattttttttttttttacgtatagccttttttttattgttaacagaccg 38744378  T
172 tcgttttattttgtgttaacccttgcttttacgagaaagacacggtaatatagagtt 228  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||    
38744379 tcgttttattttgtgttaacccttgcttttacgagaaagatacggtaatttagagtt 38744435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 84 - 129
Target Start/End: Complemental strand, 38782067 - 38782022
Alignment:
84 catttaccttatatcattaataattcagttttgaataaaagctgat 129  Q
    ||||||| ||||||||||||||| ||||||||||||||||||||||    
38782067 catttactttatatcattaataaatcagttttgaataaaagctgat 38782022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 84 - 126
Target Start/End: Complemental strand, 38788140 - 38788098
Alignment:
84 catttaccttatatcattaataattcagttttgaataaaagct 126  Q
    ||||||| |||||||||||||||||| ||||||||||||||||    
38788140 catttactttatatcattaataattccgttttgaataaaagct 38788098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University