View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18127_low_38 (Length: 244)
Name: NF18127_low_38
Description: NF18127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18127_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 76 - 228
Target Start/End: Original strand, 38744279 - 38744435
Alignment:
| Q |
76 |
gaagaagccatttaccttatatcattaataattcagttttgaataaaagctgattannnnnnn----acgtatagccnnnnnnnnattgttaacagaccg |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
38744279 |
gaagaagccatttaccttatatcattaataattcagttttgaataaaagctgattttttttttttttacgtatagccttttttttattgttaacagaccg |
38744378 |
T |
 |
| Q |
172 |
tcgttttattttgtgttaacccttgcttttacgagaaagacacggtaatatagagtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
38744379 |
tcgttttattttgtgttaacccttgcttttacgagaaagatacggtaatttagagtt |
38744435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 84 - 129
Target Start/End: Complemental strand, 38782067 - 38782022
Alignment:
| Q |
84 |
catttaccttatatcattaataattcagttttgaataaaagctgat |
129 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38782067 |
catttactttatatcattaataaatcagttttgaataaaagctgat |
38782022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 84 - 126
Target Start/End: Complemental strand, 38788140 - 38788098
Alignment:
| Q |
84 |
catttaccttatatcattaataattcagttttgaataaaagct |
126 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
38788140 |
catttactttatatcattaataattccgttttgaataaaagct |
38788098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University