View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18128_high_9 (Length: 284)
Name: NF18128_high_9
Description: NF18128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18128_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 56 - 277
Target Start/End: Original strand, 39278913 - 39279148
Alignment:
| Q |
56 |
acattgaattaatcatctatttaattgagtcaatcatattt-----cgtga--------aaaaatataacacatgtagataaaatgaatgtttgaatatc |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
39278913 |
acattgaattaatcatctatttaattgagtcaatcatattttctaacgtgattagtcaaaaaaatataacgcatgtagataaaatggatgtttgaatatt |
39279012 |
T |
 |
| Q |
143 |
attactatattgctacctctgtcctaactacagtaacatccaaaaatgattagtggtggtgggaaaagattgttttt-cttcttttgtctttattaaatc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||| |||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
39279013 |
attactatattgctacctctgtcctaaatagagtaacatccgaaaatgattagtagtggtgggaaaagattgtttttccttcttttatctttattaaatc |
39279112 |
T |
 |
| Q |
242 |
aaagatattcgtcaactataccgtcttgatgatgtc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39279113 |
aaagatattcgtcaactataccgtcttgatgatgtc |
39279148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University