View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18128_low_8 (Length: 396)
Name: NF18128_low_8
Description: NF18128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18128_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 312; Significance: 1e-176; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 5 - 380
Target Start/End: Complemental strand, 10321235 - 10320860
Alignment:
| Q |
5 |
caacagatgcaacggtgacaatactctcatcaactacaacaactgtagctgtcgttccagacatttctcccttgatactctgaaaatccatgtcagtctt |
104 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10321235 |
caacagatgcaacagtgacaatactctcatcaacaacaacaaacgtagctgtagttccagacatttctcctttgatactctgaaaatccatgtcagtctt |
10321136 |
T |
 |
| Q |
105 |
cacaaaaccagccactagagcacgaggaagggcatgtagccaagcatccctgctgctactgataatatcttgcggtattgtcttcaaaacattatttagc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
10321135 |
cacaaaaccagccactagagcacgaggaagggcatgtagccaagcatccctgctgctgctgataatatctttcggtatttccttcaaaacattatttagc |
10321036 |
T |
 |
| Q |
205 |
aagttttcttttgcataaactgcggctgatatgccgctatgcccataaaaaattgcaaatactgaaaatgcagttgatggatccccgggaacccgatggc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| || ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
10321035 |
aagttttcttttgcataaactgcggctgatataccgctatgcccatcaaaaattgcaaagaccgaaaacgcagttgatggatccccgggaacccggtggc |
10320936 |
T |
 |
| Q |
305 |
aacatgttttgatcagaccataatcttctcctttcttggtcatgctttcttctccatacttaacaaaccttttttc |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10320935 |
aacatgttttgatcagaccataatcttctcctttcttggtcatgctttcttctccatacttaacaaaccttttttc |
10320860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 95 - 257
Target Start/End: Complemental strand, 46223546 - 46223393
Alignment:
| Q |
95 |
tgtcagtcttcacaaaaccagccactagagcacgaggaagggcatgtagccaagcatccctgctgctactgataatatcttgcggtattgtcttcaaaac |
194 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||| |||||||| |||||||||||| |||||||||||||| | ||||||| |
|
|
| T |
46223546 |
tgtcagtcttcacaaaaccaacaactagagcgcgaggaagggcctgtagccatgcatccctgctg---------atatcttgcggtatcgcactcaaaac |
46223456 |
T |
 |
| Q |
195 |
attatttagcaagttttcttttgcataaactgcggctgatatgccgctatgcccataaaaaat |
257 |
Q |
| |
|
|||||| |||||||||||||||| ||||| || |||||||| ||| | ||||| | |||||| |
|
|
| T |
46223455 |
attattaagcaagttttcttttgtataaatagcagctgatataccgttgtgcccgtcaaaaat |
46223393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 343
Target Start/End: Complemental strand, 46222812 - 46222728
Alignment:
| Q |
259 |
gcaaatactgaaaatgcagttgatggatccccgggaacccgatggcaacatgttttgatcagaccataatcttctcctttcttgg |
343 |
Q |
| |
|
||||| || ||||| || |||||||||||||||||||||| |||||| ||||||||| | | ||||||||||||||||||| |
|
|
| T |
46222812 |
gcaaagacggaaaacgccgttgatggatccccgggaaccctgtggcaatctgttttgattaaaaagtaatcttctcctttcttgg |
46222728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 98 - 321
Target Start/End: Original strand, 39943046 - 39943267
Alignment:
| Q |
98 |
cagtcttcacaaaaccagccactagagcacgaggaa-gggcatgtagccaagcatccctgctgctactgataatatcttgcggtattgtcttcaaaacat |
196 |
Q |
| |
|
||||||||||||||||| |||||||| | ||| || |||| |||||||| |||||||||||| | |||| |||||| |||||| ||||||||| |
|
|
| T |
39943046 |
cagtcttcacaaaaccaaccactagaacgtgagtaatgggcgtgtagccatgcatccctgctggtgtggata---tcttgctgtattgcagtcaaaacat |
39943142 |
T |
 |
| Q |
197 |
tatttagcaagttttcttttgcataaactgcggctgatatgccgctatgcccataaaaaattgcaaatactgaaaatgcagttgatggatccccgggaac |
296 |
Q |
| |
|
|||||||||||||||| |||||||||| | |||||| | | | ||||||| ||||||||| || || | ||| |||||||| ||||||| | |||| |
|
|
| T |
39943143 |
tatttagcaagttttcctttgcataaatagaagctgatgtactgttatgcccgacaaaaattgcgaagacagtaaacgcagttgaaggatcccagagaac |
39943242 |
T |
 |
| Q |
297 |
ccgatggcaacatgttttgatcaga |
321 |
Q |
| |
|
|| |||||| ||||||||||||| |
|
|
| T |
39943243 |
cctgtggcaatctgttttgatcaga |
39943267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 99 - 346
Target Start/End: Complemental strand, 39943618 - 39943378
Alignment:
| Q |
99 |
agtcttcacaaaaccagccactagagcacgaggaagggcatgtagccaagcatccctgctgctactgataatatcttgcggtattgtcttcaaaacatta |
198 |
Q |
| |
|
|||||| ||||||||| ||||||||| | || |||| |||||||||| |||||||| || ||| |||||||||||||||||| |||| | | | |
|
|
| T |
39943618 |
agtcttaacaaaaccaaacactagagcgcaagtaaggtcatgtagccatgcatccct----ct-ctgctaatatcttgcggtattgcactcaa--cttaa |
39943526 |
T |
 |
| Q |
199 |
tttagcaagttttcttttgcataaactgcggctgatatgccgctatgcccataaaaaattgcaaatactgaaaatgcagttgatggatccccgggaaccc |
298 |
Q |
| |
|
||| ||||||||| |||||||||| || |||||| | | | ||||||||| ||||| ||||| || | || |||||||||||||||||| |||||| |
|
|
| T |
39943525 |
ttttgcaagtttttctttgcataaatagcagctgatgtactgttatgcccatgaaaaaccgcaaagacagcaaccgcagttgatggatccccgagaaccc |
39943426 |
T |
 |
| Q |
299 |
gatggcaacatgttttgatcagaccataatcttctcctttcttggtca |
346 |
Q |
| |
|
||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
39943425 |
tgaggcaatctgttttgattaaatagtaatcttctcctttcttggtca |
39943378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University