View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18129_high_14 (Length: 225)
Name: NF18129_high_14
Description: NF18129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18129_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 7905643 - 7905832
Alignment:
| Q |
16 |
ggaggatctacaaatatccatgttccagttgcttccaaagcactaaagctcaggagacatagcaagttgccaacgtggatcactttgggcctgtttaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905643 |
ggaggatctacaaatatccatgttccagttgcttccaaagcactaa-gctcaggggacatagcaagttgccaacgtggatcactttgggcctgtttaaaa |
7905741 |
T |
 |
| Q |
116 |
gaagaaggttcaatgtctgatgagatggcaagagtgaagctacaatatgagggagataacgggtgataagacaaggaagcggagatgggaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905742 |
gaagaaggttcaatgtctgatgagatggcaagagtgaagctacaatatgagggagataacgggtgataagacaaggaagcggagatgggaa |
7905832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University