View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18129_low_12 (Length: 275)
Name: NF18129_low_12
Description: NF18129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18129_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 48890102 - 48889844
Alignment:
| Q |
1 |
ataattgaagcaataatgttacaatcatgagagtataagtcatgtatttctcatttcacataggaaaatttggtatatataagacaaacaaagcattcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48890102 |
ataattgaagcaataatgttacaatcatgagagtataagtcatgtatttctcatttcacataggaaaatttggtatatataggacaaacaaagcattcag |
48890003 |
T |
|
| Q |
101 |
gcacaagacatttcaacttcatggaacagtcatatcaggctcaagttacctctctggaagcacagtcccacacaacagcttcacgattaagatcagctga |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48890002 |
gcacaagacatatcaacttcatggaacagtcatatcaggctcaagttacctctctggaagcacagtcccacacaacagcttcacgatttagatcagctga |
48889903 |
T |
|
| Q |
201 |
tgcaaacatggaaacatccggagaatatttgattacactgattgctcctcggtgcttct |
259 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48889902 |
tgcaaacatggaaacatctggagaatatttgattacactgattgctcctcggtgcttct |
48889844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 151 - 227
Target Start/End: Original strand, 45095012 - 45095088
Alignment:
| Q |
151 |
tctctggaagcacagtcccacacaacagcttcacgattaagatcagctgatgcaaacatggaaacatccggagaata |
227 |
Q |
| |
|
|||| ||| |||| |||||| ||||||||||| ||||||| ||| ||||||||||||| |||| ||| |||||||| |
|
|
| T |
45095012 |
tctcgggaggcacggtcccaaacaacagcttctcgattaacatcccctgatgcaaacattgaaaaatctggagaata |
45095088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University