View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18129_low_15 (Length: 249)
Name: NF18129_low_15
Description: NF18129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18129_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 225
Target Start/End: Complemental strand, 7923223 - 7923009
Alignment:
| Q |
11 |
aggagcacagatgcattaagttccaatccactttaagtgtagaattattgatgcaattattagtggtaattagtaatcacacaatagcataattcttttg |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7923223 |
aggaccacagatgcattaagttccaatccacttgaagtgtagaattattgatgcaattattagtggtaattagtaatcacacaatagcataattcttttg |
7923124 |
T |
|
| Q |
111 |
attattaatataaataagattagtgattaacaaaaaccaacacggcctactgatgaggccctagtttctggttttgttaaattgatgaagcagtttacat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7923123 |
attattaatataaataagattagtgattaacaaaaaccaacacggcctactgatgaggccctagtttctggttttgttaaattgatgaagcagtttacat |
7923024 |
T |
|
| Q |
211 |
gaagccggaattatg |
225 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
7923023 |
gaagccagaattatg |
7923009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University