View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18129_low_17 (Length: 226)
Name: NF18129_low_17
Description: NF18129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18129_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 21 - 88
Target Start/End: Original strand, 21254745 - 21254812
Alignment:
| Q |
21 |
cttgtttgttttcttgattggaatcttcttcgttgtttaatttcaaggttccttcgatttcagaattc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
21254745 |
cttgtttgttttcttgattggaatcttcttccttgttcaatttcaaggttccttcaatttcagaattc |
21254812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University