View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18129_low_7 (Length: 356)
Name: NF18129_low_7
Description: NF18129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18129_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 218 - 344
Target Start/End: Original strand, 17724880 - 17725006
Alignment:
| Q |
218 |
atgtaaaattttggaatgtagtgcaacattctcatgatgcttgataatcaatttttctgtttggatcattgcataattttggtcgacatgaaagaactgt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17724880 |
atgtaaaattttggaatgtagtgcaacattctcatgatgcttgattgtcaatttttgtgtttggatcattgcataattttggtcgacatggaagaactgt |
17724979 |
T |
|
| Q |
318 |
tgaattgatttatgatgattggtgtgg |
344 |
Q |
| |
|
||||||||| |||| |||||||||||| |
|
|
| T |
17724980 |
tgaattgatatatgttgattggtgtgg |
17725006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 11 - 116
Target Start/End: Original strand, 17724672 - 17724777
Alignment:
| Q |
11 |
gaacctgtgaaactgttgtatataaaaaggatcggttatttcggcggaagatgcgttcgttgattaaggcaaatgcaacgtgttgatggttgcggaaata |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17724672 |
gaaccggtgaaactgttgtatataaaaaggatcggttatttcggcagaagatgcgttcgttgattaaggcaaatgcaacgtgttgatggttgcggaaata |
17724771 |
T |
|
| Q |
111 |
tctaga |
116 |
Q |
| |
|
|||||| |
|
|
| T |
17724772 |
tctaga |
17724777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University