View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18129_low_9 (Length: 317)
Name: NF18129_low_9
Description: NF18129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18129_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 48890128 - 48890434
Alignment:
| Q |
1 |
aacttactgaaaaatgccgttgctaaataaatcttcctttctctttcaggtggtgcttaataacatgttgtttcacactgcacgtgtaaactgtcttgct |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890128 |
aacttactgaaaaatgtcgttgctaaataaatcttcctttctctttcaggtggtgcttaataacatgttgtttcacactgcacgtgtaaactgtcttgct |
48890227 |
T |
 |
| Q |
101 |
tggtcacctaatagcaaactggtagctactggttcacttgatacatgtgttattgtatacgaaattggaaagccagcatcaagccgcagaaccataaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890228 |
tggtcacctaatagcaaactggtagctactggttcacttgatacatgtgttattgtatacgaaattggaaagccagcatcaagccgcagaaccataaaag |
48890327 |
T |
 |
| Q |
201 |
gggctcatttaggtggagtgtatggcttgacttttattgagccagaaagagtggtcagttcgggagaagatagttgcgttcgtgtttgggatttaatttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890328 |
gggctcatttaggtggagtgtatggcttgacttttattgagccagaaagagtggtcagttcgggagaagatagttgcgttcgtgtttgggatttaatttc |
48890427 |
T |
 |
| Q |
301 |
agaataa |
307 |
Q |
| |
|
||||||| |
|
|
| T |
48890428 |
agaataa |
48890434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University