View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18130_high_12 (Length: 246)
Name: NF18130_high_12
Description: NF18130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18130_high_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 61 - 246
Target Start/End: Original strand, 41314060 - 41314244
Alignment:
| Q |
61 |
accaacacaactgcatgcaagtagccacgtgtccaatccaaaatctcaactctttcctctcttcaacgnnnnnnnnnnnnnnnnnnnatgccagaaccaa |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
41314060 |
accaacacaactccatgcaagtagccacgtgtccaagccaaaatctcaactctttcctctcttcaacgtctctctctctctctc----tgccacaaccaa |
41314155 |
T |
 |
| Q |
161 |
----cccaacactaacacacacattccttttcagacaatggtgaaactagcttcagcaagagagttccgtacatacggcccgggcctcac |
246 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314156 |
ccaacccaacact-acacacacattccttttcagacaatggtgaaactagcttcagcaagagagttccgtacatacggcccgggcctcac |
41314244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University