View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18130_high_15 (Length: 230)
Name: NF18130_high_15
Description: NF18130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18130_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 51278125 - 51278326
Alignment:
| Q |
13 |
aagaatgggaaatttgacgaggcaatgaagctttttaataggatgatcaaggagcataatcctccggctaagttggctgttaatttgggaagctttaatg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51278125 |
aagaatgggaaatttgacgaggcaatgaagctttttaataggatgatcaaggagcataatcctccagctaagttggctgttaatttgggaagctttaatg |
51278224 |
T |
 |
| Q |
113 |
tcatggtggatggttattgtgccgagggaaaattcaaggaggctattgaaattttcaggagcatgggtgagtctcgttgcaagccagatacattgtcatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51278225 |
tcatggtggatggttattgtgccgagggaaaattcaaggaggcgattgaaattttcaggagcatgggtgagtctcgttgcaagccagatacattgtcatt |
51278324 |
T |
 |
| Q |
213 |
ta |
214 |
Q |
| |
|
|| |
|
|
| T |
51278325 |
ta |
51278326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 41617971 - 41618172
Alignment:
| Q |
13 |
aagaatgggaaatttgacgaggcaatgaagctttttaataggatgatcaaggagcataatcctccggctaagttggctgttaatttgggaagctttaatg |
112 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41617971 |
aagaatgggaaatttgatgaggcaatgaggctctttgataggatgatcaaggagcataatcctcctgctaagttggctgttaatttgggaagctttaatg |
41618070 |
T |
 |
| Q |
113 |
tcatggtggatggttattgtgccgagggaaaattcaaggaggctattgaaattttcaggagcatgggtgagtctcgttgcaagccagatacattgtcatt |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
41618071 |
tcatggtggatggttattgtgctgagggaaaattcaaggaggcgattgaggttttcaggagcatgggtgagtctcgttgtaagcctgatacgttgtcatt |
41618170 |
T |
 |
| Q |
213 |
ta |
214 |
Q |
| |
|
|| |
|
|
| T |
41618171 |
ta |
41618172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University