View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18130_low_14 (Length: 289)
Name: NF18130_low_14
Description: NF18130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18130_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 272
Target Start/End: Complemental strand, 7901288 - 7901026
Alignment:
| Q |
12 |
atgaaacttcccaagcttgccattatgttctgcttgatgtttaacttctttttacttattttgaatcttgtgagtacagatacattgtggtgcacatata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7901288 |
atgaaacttcccaagcttgccattatgttctgcttgatgtttaacttctttttacttattttgaatcttgtgagtacagatacattgtggtgcacatata |
7901189 |
T |
|
| Q |
112 |
tatacnnnnnnnnnnnnnnnnnn--ttgaatacttgtaatgagaaggtaaaatgatctatcagtttgttgcatgaaggataaaaagtgagctaggttaat |
209 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7901188 |
tatacgtgtgtgtgtgtgtgtgtgtttgaatacttgtattgagaaggtgaaatgatctatcagtttgttgcatgaaggataaaaagtgagctaggttaat |
7901089 |
T |
|
| Q |
210 |
ttggtagttccttaatgagttgtatactttgtaaaataatgataaattttttgaaggtattgg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7901088 |
ttggtagttccttaatgagttgtatactttgtaaaataatgataaattttttgaaggtattgg |
7901026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 62
Target Start/End: Complemental strand, 31213322 - 31213273
Alignment:
| Q |
13 |
tgaaacttcccaagcttgccattatgttctgcttgatgtttaacttcttt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31213322 |
tgaaacttcccaagcttgccattatgttctgcttgatgtttaacttcttt |
31213273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University