View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18130_low_21 (Length: 237)
Name: NF18130_low_21
Description: NF18130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18130_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 34 - 159
Target Start/End: Complemental strand, 41313971 - 41313846
Alignment:
| Q |
34 |
tggttatggttatggttagtgggcctatgttgggcttacgtttccttaagacccaagcaagaggagtgaatgaaacaaacaaaaaatatacgaactaatt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
41313971 |
tggttatggttatggttagtgggcctatgttgggcttacgtttccttaagacccaagcaagaggagtaaatgaaacaaacaaaaaagataccaactaatt |
41313872 |
T |
 |
| Q |
134 |
cactgttctagacttgtagatttttc |
159 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41313871 |
cactgttctagacttgtagatttttc |
41313846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 51
Target Start/End: Complemental strand, 41313990 - 41313960
Alignment:
| Q |
21 |
atgtcaacagatctggttatggttatggtta |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41313990 |
atgtcaacagatctggttatggttatggtta |
41313960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University