View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18130_low_22 (Length: 237)
Name: NF18130_low_22
Description: NF18130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18130_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 38284120 - 38284340
Alignment:
| Q |
1 |
cgatggcattgatgatacgaaacttaaaattatagaacactttaaaatttggatatttaggaaatacgannnnnnnn---atagataaatcttacaatgt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38284120 |
cgatggcattgatgatacgaaacttaaaattatagaacactttaaaatttggatatttaggaaatacgatttttttttttatagataaatcttacaatgt |
38284219 |
T |
|
| Q |
98 |
tagtaattatattagttttcgagaatcaaaaccggatacctcttttttcaaactctttcagcgtcgcttacctcattaacctattttagc-ggggatgaa |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
38284220 |
tagtaattatattagtttccgagaatcaaaaccggatacctcttttttcaaactctttcggcgtctcttacctcattaacctattttagcgggggatgaa |
38284319 |
T |
|
| Q |
197 |
tgaaaattctagtcacatagt |
217 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38284320 |
tgaaaattctagtcacatagt |
38284340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University