View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18131_high_20 (Length: 243)
Name: NF18131_high_20
Description: NF18131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18131_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 35140277 - 35140504
Alignment:
| Q |
1 |
ttatggtttattgtccttttgtctttcatttgtctgtgatttagagaaggatgtaagcaactaagattccttaagatatgtctatggg-tatggcatgtg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35140277 |
ttatggtttattgtccttttgtctttcatttgtctgtgatttagagaaggatgtaagcaactaagattccttaagatatgtctatgggctatggcatgtg |
35140376 |
T |
|
| Q |
100 |
gactggcattgctttgagaatgcaaaaccccacaaggttccagcatgatacaggcagnnnnnnnnccaacgtgctgtctttggattgagacatgaacact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
35140377 |
gactggcattgctttgagaatgcaaaaccccacaaggttccagcatgatacaggcag-aaaaaaaccaacgtgctgtctttggattgagacatgaacaat |
35140475 |
T |
|
| Q |
200 |
caacatcaatgttcgccaaacatgttcat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35140476 |
caacatcaatgttcgccaaacatgttcat |
35140504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University