View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18131_high_23 (Length: 229)

Name: NF18131_high_23
Description: NF18131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18131_high_23
NF18131_high_23
[»] chr4 (1 HSPs)
chr4 (20-219)||(30772759-30772959)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 30772959 - 30772759
Alignment:
20 tgaggctcattcattcagtcttagcaagtactctat-tttatgtaatgtaacaaatacatgcagtcgttttccaggagtgcaccattgttatgtactttt 118  Q
    ||||||||||||||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
30772959 tgaggctcattcattcagtcttagcaagtgctctatctttatgtaatgtaacacatacatgcagtcgttttccaggagtgcaccattgttatgtactttt 30772860  T
119 gtctttaactgcatgcatgccattctcagcagccaacgaagaatctctctcctgtcatgtagttttcaagaacctcatcataaactacaacttgccttca 218  Q
    |||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
30772859 gtctttaactgcatgcatgccactctcagcagccaacgaagactctctctcatgtcatgtagttttcaagaacctcatcataaactacaacttgccttca 30772760  T
219 t 219  Q
    |    
30772759 t 30772759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University