View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18131_low_12 (Length: 347)
Name: NF18131_low_12
Description: NF18131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18131_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 20 - 331
Target Start/End: Original strand, 7979543 - 7979854
Alignment:
| Q |
20 |
gaagccagaagtttcttggtaaagtctgaatccaaatgtgattaattcatatatttgtgctgaagcatccaaaggcttccattttatacttttggcagaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7979543 |
gaagccagaagtttcttggtaaagtctgaatccaaatgtgattaattcatatatttgtgctgaagcatccaaaggcttcaattttatacttttggcagaa |
7979642 |
T |
|
| Q |
120 |
tacatgaatatactgtaactattattcgatataccttagattcggatatttgattattaaaaatttaaaattgctgatcttgaattccactgttacatgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7979643 |
tacatgaatatactgtaactattattcgaaataccttagattcggatatttgattattaaaaatttaaaattgctgatcttgaattccactgttacatat |
7979742 |
T |
|
| Q |
220 |
gcttgatactagaaatgcactctagttttggatagagaaatatatagtagcaatatacactatactcttgcattatgctcataagcatcgatcaatcatc |
319 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7979743 |
gcttgatactagaaattcactctagttttggatagagaaatatatagtggcaatatacactatactcttgcattatgctcataagcatcgatcaatcatc |
7979842 |
T |
|
| Q |
320 |
cgatgcattatg |
331 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7979843 |
cgatgcattatg |
7979854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University