View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18131_low_16 (Length: 302)
Name: NF18131_low_16
Description: NF18131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18131_low_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 7 - 302
Target Start/End: Complemental strand, 55300470 - 55300175
Alignment:
| Q |
7 |
gcatcaatgacaagagagtaatcggtaagacctttgtagtaaggactactgtggggggatgatgaaacgaggataggtcgcagtgatgaagagatattgt |
106 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
55300470 |
gcatcaatgacaagagaataatcggtaagacctttgtagtaaggactactgtggggggatgatgaaaggaggataggtcgcagtgatgaagagatattgt |
55300371 |
T |
 |
| Q |
107 |
tgttgtcatcctcttggtattcttcatgaggaatagcaagagattgatcggtgagacccttgtagtagggactatcagaagagaggtgagcatgatgagt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55300370 |
tgttgtcatcctcttggtattcttcatgaggaatagcaagagattgatcggtaagacccttgtagtagggactatcagaagagaggtgagtatgatgagt |
55300271 |
T |
 |
| Q |
207 |
catatcatatgagtcaacctctttcttcatccatgatattgatgacaaccaccaatgaccactgttcttcctcctccgtgcggaacgtgacatatt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300270 |
catatcatatgagtcaacctctttcttcatccatgatattgatgacaaccaccaatgaccactgttcttcctcctccgtgcggaacgtgacatatt |
55300175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University