View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18131_low_19 (Length: 257)
Name: NF18131_low_19
Description: NF18131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18131_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 17681755 - 17681590
Alignment:
| Q |
1 |
tctaattctcctactgcctaacacttcttcttttatcatcggattaagcttcaacggataaaacattcttagccacacatagctttactcagtctagtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
17681755 |
tctaattctcctactgcctaacacttcttcttttatcatcggattaagctgcaacggacaaaacattcttagccacacatagccttactcagtctaatca |
17681656 |
T |
 |
| Q |
101 |
aaccgcgtactttgtccaccagctcgatcgaacctgctagtaattgcttcacagattcgttacccc |
166 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
17681655 |
aaccgcgtactttgtccgacagctgaatcgaacatgcttgtaattgcttcacatattcgttacccc |
17681590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 240
Target Start/End: Complemental strand, 17681470 - 17681427
Alignment:
| Q |
197 |
gggttaagctgcgcaacagacaaaacatgtctttttcttactct |
240 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
17681470 |
gggttaagcttcgcagcagacaaaacatgtctttttcttactct |
17681427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University