View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18131_low_24 (Length: 229)
Name: NF18131_low_24
Description: NF18131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18131_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 30772959 - 30772759
Alignment:
| Q |
20 |
tgaggctcattcattcagtcttagcaagtactctat-tttatgtaatgtaacaaatacatgcagtcgttttccaggagtgcaccattgttatgtactttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30772959 |
tgaggctcattcattcagtcttagcaagtgctctatctttatgtaatgtaacacatacatgcagtcgttttccaggagtgcaccattgttatgtactttt |
30772860 |
T |
 |
| Q |
119 |
gtctttaactgcatgcatgccattctcagcagccaacgaagaatctctctcctgtcatgtagttttcaagaacctcatcataaactacaacttgccttca |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30772859 |
gtctttaactgcatgcatgccactctcagcagccaacgaagactctctctcatgtcatgtagttttcaagaacctcatcataaactacaacttgccttca |
30772760 |
T |
 |
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
30772759 |
t |
30772759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University