View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18132_high_32 (Length: 211)

Name: NF18132_high_32
Description: NF18132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18132_high_32
NF18132_high_32
[»] chr4 (1 HSPs)
chr4 (15-196)||(46549400-46549581)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 46549400 - 46549581
Alignment:
15 cataggtcaatgttttagagagtgacccattaaagtttttgcatatggtgaaatgtgggattttgggatccataaaataaatgtttatagttatcacaag 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46549400 cataggtcaatgttttagagagtgacccattaaagtttttgcatatggtgaaatgtgggattttgggatccataaaataaatgtttatagttatcacaag 46549499  T
115 ccnnnnnnnnnnnnnnnnncaatgaatgatgtgcaggattgatctactataaagtttggagtgactataactacaccaaatt 196  Q
    ||                 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46549500 ccaaaagtaaaataaaaaacaatgaatgatgtgcaggattgatctactataaagtttggagtgactataactacaccaaatt 46549581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University