View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18133_high_5 (Length: 258)
Name: NF18133_high_5
Description: NF18133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18133_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 111 - 240
Target Start/End: Complemental strand, 29092806 - 29092677
Alignment:
| Q |
111 |
caagtcattggttcttgatctgctctcatgatcagtgcttctcattaccatgttatttctctctaactttacaagaaaaatttgtgattctttgctggca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29092806 |
caagtcattggttcttgatctgctctcatgatcagtgcttctcattaccatgttatttctctctaactttacaagaaaaatttgtgattctttgctggca |
29092707 |
T |
 |
| Q |
211 |
ttacttcattttagtgcccatgtctttggt |
240 |
Q |
| |
|
||||||||| | |||||||||||||||||| |
|
|
| T |
29092706 |
ttacttcatatcagtgcccatgtctttggt |
29092677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 29092871 - 29092803
Alignment:
| Q |
9 |
gattatactgcaaataacttactattttgttaatttattccaaagnnnnnnnattggagtatttacaag |
77 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29092871 |
gattacactgcaaataactttctattttgttaatttattccaaagtttttttattggagtatttacaag |
29092803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University