View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18133_low_3 (Length: 349)
Name: NF18133_low_3
Description: NF18133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18133_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 22 - 334
Target Start/End: Original strand, 3189338 - 3189650
Alignment:
| Q |
22 |
taattaataaagaatattgtattggtgatgatggagctagttctagttatgagggtagtaacattattattttgtgcatttggggaattcattgaaggtg |
121 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3189338 |
taattaataaagaatattgtattggtggtgatggagctagttctagttatgagggtagtaacattattattttgtgcatttggggaattcattgaaggtg |
3189437 |
T |
|
| Q |
122 |
aatattgtttggagggaaacaaagataaggcaatggctaacgtgtggagggacttggaactgcttattctccctttcttctcctcttgtttcactatctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3189438 |
aatattgtttggagggaaacaaagataaggcaatggctaacgtgtggagggacttggaactgcttattctccctttcttctcctcttgtttcactatctt |
3189537 |
T |
|
| Q |
222 |
tttcataataatatcaacatcaacatcaaaatcctaggtagtaatactttctttgttgcctcatgttttaagctatcacgtgggcataggtggacctata |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3189538 |
tttcataataatatcaacatcaacatcaaaatcctaggtagtaatactttctttgttgcctcatgttttaagctatcacgtgggcataggtggacctata |
3189637 |
T |
|
| Q |
322 |
taattaatgtact |
334 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3189638 |
taattaatgtact |
3189650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University