View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18134_low_5 (Length: 269)
Name: NF18134_low_5
Description: NF18134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18134_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 9087057 - 9086822
Alignment:
| Q |
16 |
ctgtgtgtctattataaaccaaaatttatttttcggctgagccatggaaggttggaataatgttacatattgcaggttaacaaagtctaagtctgatcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9087057 |
ctgtgtgtctattataaaccaaaatttatttttcggctgagccatggaaggttggaataattttacatattgcaggttaacaaagtctaagtctgatcat |
9086958 |
T |
 |
| Q |
116 |
catcctattctattgtatatgactaatgcaatctaatgcttgtgctccataagaagttacagctccgaaatgtggctttgaaaatttggaataaggacnn |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9086957 |
catcctattctattgtatatgactaatgcaatcttatgcttgtgcttcataagaagttacagctccgaaatgtggctttgaaaatttggattaaggac-- |
9086860 |
T |
 |
| Q |
216 |
nnnnnnnggagatattaaggctatcagagaggttgatt |
253 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
9086859 |
tttttttgaagatattaaggctatcagagaggttgatt |
9086822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University