View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18135_low_5 (Length: 237)
Name: NF18135_low_5
Description: NF18135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18135_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 32525542 - 32525315
Alignment:
| Q |
1 |
cattctacgtcagaagagatgagtgccttaaagtactaagttcgctttctgacacaatatcccttcctaaatttgacaaaagagataacatgagagttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32525542 |
cattctacgtcagaagagatgagtgccttaaagtactaagttcgctttctgacacaatatcccttcctaaatttgacaaaagagataacatgagagttga |
32525443 |
T |
|
| Q |
101 |
agtaggaaacttttgcttgtcaaatgcttgcctaatcttctgtactgcatcaagttctgttaaactatacacagcggag------ccaattcaattttta |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
32525442 |
agtaggaaacttttgcttgtcaaatgcttgcctaatcttctgtactgcatcaagttctgttaaactatacacagccgaggtgagcccaattcaattttta |
32525343 |
T |
|
| Q |
195 |
gtaatcgatgaagcggcacagctaaaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32525342 |
gtaatcgatgaagcggcacagctaaaag |
32525315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 32531950 - 32531888
Alignment:
| Q |
6 |
tacgtcagaagagatgagtgccttaaagtactaagttcgctttctgacacaatatcccttcct |
68 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||| | ||| | ||||||||| |
|
|
| T |
32531950 |
tacgtcaaaagagatgagtgccttagcatactaagttcgctttctaaaacagtttcccttcct |
32531888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University