View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18136_high_17 (Length: 252)
Name: NF18136_high_17
Description: NF18136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18136_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 19810013 - 19809779
Alignment:
| Q |
1 |
tctgtcttcttttgggttgagaagagaccgattatgagattatgcccttgttgccacaacgtggacacaatttcatcccaccaaagtcgaccaaatggct |
100 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
19810013 |
tctgccttcttttgggtcgagaagagaccagttatgagattatgcccttgttgccacagcgtggacacaacttcatcccaccaaagtcgaccaaatagct |
19809914 |
T |
 |
| Q |
101 |
taaaggaggttccgcgaacaaatgtcatgacacataatctggaaccaaaggcttcccagattttagcaccttcaactccaccgaggctttgagttaggat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19809913 |
taaaggaggttccgcgaacaaatgtcatggcacataatctggaaccaaaggcttcccagattttagcaccttcaactccaccgaggctttgagttaggat |
19809814 |
T |
 |
| Q |
201 |
aaggatcctttgttttgtttcatgattagagtatt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19809813 |
aaggatcctttgttttgtttcatgattagagtatt |
19809779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 64 - 99
Target Start/End: Original strand, 9390264 - 9390299
Alignment:
| Q |
64 |
gacacaatttcatcccaccaaagtcgaccaaatggc |
99 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9390264 |
gacacaatttcgtcccaccaaagtcgaccaaatggc |
9390299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 99
Target Start/End: Original strand, 1338094 - 1338133
Alignment:
| Q |
60 |
cgtggacacaatttcatcccaccaaagtcgaccaaatggc |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1338094 |
cgtggacacaatttcgtcccaccaaagtcgaccaaatggc |
1338133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 61 - 99
Target Start/End: Original strand, 5639983 - 5640021
Alignment:
| Q |
61 |
gtggacacaatttcatcccaccaaagtcgaccaaatggc |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5639983 |
gtggacacaatttcgtcccaccaaagtcgaccaaatggc |
5640021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 64 - 99
Target Start/End: Original strand, 31939911 - 31939946
Alignment:
| Q |
64 |
gacacaatttcatcccaccaaagtcgaccaaatggc |
99 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31939911 |
gacacaatttcgtcccaccaaagtcgaccaaatggc |
31939946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University