View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18136_high_21 (Length: 241)
Name: NF18136_high_21
Description: NF18136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18136_high_21 |
 | |
|
| [»] scaffold0012 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0012 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 145
Target Start/End: Original strand, 118026 - 118063
Alignment:
| Q |
108 |
acatgtagtttggtaaatcataattaatatgaatattg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
118026 |
acatgtagtttggtaaatcataattaatatgaatattg |
118063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 145
Target Start/End: Original strand, 20479797 - 20479834
Alignment:
| Q |
108 |
acatgtagtttggtaaatcataattaatatgaatattg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479797 |
acatgtagtttggtaaatcataattaatatgaatattg |
20479834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 143
Target Start/End: Original strand, 20370670 - 20370705
Alignment:
| Q |
108 |
acatgtagtttggtaaatcataattaatatgaatat |
143 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20370670 |
acatgtagtttggtaaatcttaattaatatgaatat |
20370705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 92
Target Start/End: Complemental strand, 15058811 - 15058751
Alignment:
| Q |
32 |
gttgcaacaagcaatttctatcgtgaatatgtcgctggaaattttgtcgagaagtttagca |
92 |
Q |
| |
|
|||||||||||| | ||| ||||||||| |||||||| | ||||| ||| ||||||||||| |
|
|
| T |
15058811 |
gttgcaacaagccaattccatcgtgaatttgtcgctgtacattttttcgggaagtttagca |
15058751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University