View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18136_high_8 (Length: 449)
Name: NF18136_high_8
Description: NF18136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18136_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 342; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 73 - 434
Target Start/End: Complemental strand, 43865079 - 43864718
Alignment:
| Q |
73 |
atatgcaacaatgctgttcctttgaccccgtcaccacttcaatctgaaccagagtatccaaattccaaacaccttttgtaccttacagttttatttctta |
172 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
43865079 |
atatgcaacaatgttgttcctttgaccccgtcaccacttcaatctgaaccagagtatccaaattccaaacaccttttgtaccttacaattttagttctta |
43864980 |
T |
 |
| Q |
173 |
gcatacaagattctgacgtcttcagttcctttgacatgcctaaggatattatttttgacgcaataaaatgagaatgttgcatgcctcaccatgaccccca |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43864979 |
gcatacaagattctgacgtcttcagttcctttgacatgcctaaggatattatttttgacgcaataaaatgagaatgttgcatgcctcaccatgaccctca |
43864880 |
T |
 |
| Q |
273 |
tgatcaatcatactccatatgttatatcaggcctaatgtgacacatatctcaatgatccaactatctgcttatacctttatttggtacattgctctccgg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43864879 |
tgatcaatcatactccatatgttatatcaggcctaatgtgacacatatctcaatgatccaactatctgcttatacctttatttggtacattgctctctgg |
43864780 |
T |
 |
| Q |
373 |
gtgccagccttgtgtttcatcaaatctcacatctttgttaaacattatcttcttgcttttag |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864779 |
gtgccagccttgtgtttcatcaaatctcacatctttgttaaacattatcttcttgcttttag |
43864718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 73 - 111
Target Start/End: Complemental strand, 43858370 - 43858332
Alignment:
| Q |
73 |
atatgcaacaatgctgttcctttgaccccgtcaccactt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43858370 |
atatgcaacaatgctgttcctttgaccccgtcaccactt |
43858332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University