View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18136_low_14 (Length: 321)
Name: NF18136_low_14
Description: NF18136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18136_low_14 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 18 - 321
Target Start/End: Complemental strand, 19501 - 19198
Alignment:
| Q |
18 |
aacctctgctaaatttttaattccaattgagcttctaaatatcctactcactaccaagtgttaccaaaagttttttacatttgaaaaatcaagttaatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19501 |
aacctctgctaaatttttaattccaattgagcttctaaatatcctactcactaccaagtgttaccaaaagttttttacatttgaaaaatcaagttaatat |
19402 |
T |
 |
| Q |
118 |
agattttagtactaatgtctctggaacaatgcttgttctttcttgcagaatttaaaagcaggcactggagcacgcagaacgaaggcctcctctggttgcc |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19401 |
agattttagcactaatgtctctggaacaatgcttgttctttcttgcagaatttaaaagcaggcacaggagcacgcagaacgaaggcctcctctggttgcc |
19302 |
T |
 |
| Q |
218 |
caatgcttagaaaacgcagactacaacaagaattcaggaatgaggtatctcaacaagggcctttggatattgaagatcttgctaaccttggaagaactat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19301 |
caatgcttagaaaacgcagactacaacatgaattcaggaatgaggtatctcaacaagggcctttggatattgaagatcttgctaaccttggaagaactat |
19202 |
T |
 |
| Q |
318 |
ggga |
321 |
Q |
| |
|
|||| |
|
|
| T |
19201 |
ggga |
19198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University