View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18136_low_16 (Length: 271)
Name: NF18136_low_16
Description: NF18136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18136_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 20 - 259
Target Start/End: Original strand, 40515485 - 40515707
Alignment:
| Q |
20 |
gtctggcagtgactgttaactctaggacatgtctatcaataactatttttatgtacaattgccaattttgttgagggttgttggatggggcatgaaatag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515485 |
gtctggcagtgactgttaactctaggacatgtctatcaataactatttttatgtataattgccaattttgttgagggttgttggatggggcatgaaatag |
40515584 |
T |
 |
| Q |
120 |
ttattgcatctagcaatcacnnnnnnnnnnnnnnntcagcgtccttatcttactggctgttttcaatggaccgctggtgatgaaaatattggtggtggat |
219 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40515585 |
ttattgcatctagcaatcacaaaaaggaaaaaaaatcagcgtccttatcttactg-----------------gctggtgatgaaaatattggtggtggat |
40515667 |
T |
 |
| Q |
220 |
tggaatttcttaaggttgagccgtggctatgattgtcctt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515668 |
tggaatttcttaaggttgagccgtggctatgattgtcctt |
40515707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University