View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18136_low_17 (Length: 267)
Name: NF18136_low_17
Description: NF18136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18136_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 23 - 265
Target Start/End: Original strand, 34815285 - 34815526
Alignment:
| Q |
23 |
tagttacctataaattgatcagtcataatttgaatattcaaaaagatgttcaccatataacctaaagtacnnnnnnngttctgaggaattaaatcccagt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34815285 |
tagttacctataaattgatcagtcataatttgaatattcaaaaagatgttcaccatataacctaaagtactttttttgttctgaggaattaaatcccagt |
34815384 |
T |
|
| Q |
123 |
cccataaagaatatattcattgcatcacannnnnnnnnnggnnnnnnngctttttcttttcatttgcatagtcaaacctgcatgatgtagtatagactgt |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34815385 |
cccataaagaagatattcattgcatcaca-tttttttttggaaaaaaagctttttcttttcatttgcatagtcaaacctgcatgatgtagtatacactgt |
34815483 |
T |
|
| Q |
223 |
gtgattgaagtttttctcactgaattcagtaaacagacctttg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34815484 |
gtgattgaagtttttctcactgaattcagtaaacagacctttg |
34815526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University