View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18136_low_19 (Length: 243)
Name: NF18136_low_19
Description: NF18136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18136_low_19 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 74 - 243
Target Start/End: Original strand, 12196422 - 12196592
Alignment:
| Q |
74 |
gtctcttctaatgtaccattcagaaatgcaaactttactagttgctaacgctataaccaatctgatagtttcatgtcttgcaact-gtgagaaaacttta |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
12196422 |
gtctcttctaatgtaccattcagaaatgcaaactttactagttgctaatactataaccaatctgatagtttcatgtcttgcatctggtgagaaaacttta |
12196521 |
T |
|
| Q |
173 |
gtgtaatcaaaactttccttctaaataaacctctagccaaaagccttgctttgtgcttcacaatcttccct |
243 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
12196522 |
gtgtaatcaaaaccttccttctaaataaacctctagccaaaagccttgcttcgtgattcacaatcttccct |
12196592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 12196333 - 12196375
Alignment:
| Q |
18 |
gtttcaaaccatataaggctttgctcaatctgaacactctatc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12196333 |
gtttcaaaccatataaggctttgctcaatctgaacactctatc |
12196375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 132 - 242
Target Start/End: Original strand, 6372476 - 6372589
Alignment:
| Q |
132 |
aatctgatagtttcatgtctt-gcaactg-tgagaaaactttagtgtaatcaaaactttccttcta-aataaacctctagccaaaagccttgctttgtgc |
228 |
Q |
| |
|
|||||||||||||||||| || |||| || ||||||||||| |||||||||||| | ||| ||||| || ||||||||||||| ||| |||||||| || |
|
|
| T |
6372476 |
aatctgatagtttcatgtttttgcaattggtgagaaaacttcagtgtaatcaaagccttcattctataagaaacctctagccacaagtcttgctttttga |
6372575 |
T |
|
| Q |
229 |
ttcacaatcttccc |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6372576 |
ttcacaatcttccc |
6372589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 194
Target Start/End: Complemental strand, 33684593 - 33684521
Alignment:
| Q |
123 |
gctataaccaatctgatagtttcatgtcttgcaact-gtgagaaaactttagtgtaatcaaaactttccttct |
194 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| |||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
33684593 |
gctataatcaatctgatagtttcatgccttgcaactggtgagaaaacttcagtgtaatcaaaaccttctttct |
33684521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 194
Target Start/End: Complemental strand, 33701647 - 33701575
Alignment:
| Q |
123 |
gctataaccaatctgatagtttcatgtcttgcaact-gtgagaaaactttagtgtaatcaaaactttccttct |
194 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| |||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
33701647 |
gctataatcaatctgatagtttcatgccttgcaactggtgagaaaacttcagtgtaatcaaaaccttctttct |
33701575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 243
Target Start/End: Complemental strand, 14639886 - 14639775
Alignment:
| Q |
134 |
tctgatagtttcatgtcttgcaactg-tgagaaaactttagtgtaatcaaaactttccttcta-aataaacctctagccaaaagccttgctttgtgcttc |
231 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||| |||| ||| |||||||| | |||||||| || ||| ||||||||| ||| || |||||||||||| |
|
|
| T |
14639886 |
tctgatggtttcatgtcttggaactggtgagaacacttcagtataatcaaagccttccttcttcaagaaaactctagccacaagtctagctttgtgcttc |
14639787 |
T |
|
| Q |
232 |
acaatcttccct |
243 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14639786 |
acaatcttccct |
14639775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University