View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18137_high_5 (Length: 345)
Name: NF18137_high_5
Description: NF18137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18137_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 28143429 - 28143645
Alignment:
| Q |
1 |
attgtcaatgttgtgtgttcaacctttttgacttgatatcctctcggaatacatgtttcgacactcataattaggatctgatgctttaattcacttcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28143429 |
attgtcaatgttgtgtgttcaacctttttgacttgatatcctctcggaatacatgtttcgacactcataattaggatctgatgctttaattcacttcttg |
28143528 |
T |
|
| Q |
101 |
tatatgcaacaatagtacatttgtaaatttgtcagcttgacagaagctttacttttaattgcattgaaagagacggtatgaatctattcaagcttattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28143529 |
tatatgcaacaatagtacatttgtaaatttgtcagcttgacagaagctttacttttaattgcattgaaagagacggtatgaatctattcaagcttattta |
28143628 |
T |
|
| Q |
201 |
gtttaatacaatggtac |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28143629 |
gtttaatacaatggtac |
28143645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 292 - 330
Target Start/End: Original strand, 28143720 - 28143758
Alignment:
| Q |
292 |
agtaggatgttacctgtggaagggcttaccgaggtttat |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28143720 |
agtaggatgttacctgtggaagggcttaccgaggtttat |
28143758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University