View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18138_high_27 (Length: 227)

Name: NF18138_high_27
Description: NF18138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18138_high_27
NF18138_high_27
[»] chr5 (2 HSPs)
chr5 (113-210)||(527249-527347)
chr5 (15-54)||(527149-527188)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 113 - 210
Target Start/End: Original strand, 527249 - 527347
Alignment:
113 ttgctccatattttttgaacttggtttt-gtcatcagtttcttcaagcagtgtcctaatcctaatgatgctcagagaagagagctgagccttcggactg 210  Q
    |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
527249 ttgctccatattttttgaacttggtttttgtcatcagcttcttcaagcagtgtcctaatcctaatgatgctcagagaagagagctgagccttcggactg 527347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 54
Target Start/End: Original strand, 527149 - 527188
Alignment:
15 cacagagcaacaaattgatgaaatggatacgtaggaacca 54  Q
    |||| |||||||||||||||||||||||||||||||||||    
527149 cacacagcaacaaattgatgaaatggatacgtaggaacca 527188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University