View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18138_high_7 (Length: 422)
Name: NF18138_high_7
Description: NF18138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18138_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 1 - 410
Target Start/End: Original strand, 23887402 - 23887811
Alignment:
| Q |
1 |
cttcaacactcttggttcaggtgcggatggtttgaggaaggaaatgatagattttcttacgctaagaagtgaatcgtttgttgctgaggttgttatcttg |
100 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
23887402 |
cttcaacactcctggttcagttgcggatggtttgaggaaggaaatgatagattttcttacgctgagaagtgaatcgtttgttgctgagactgttatcttg |
23887501 |
T |
 |
| Q |
101 |
gatgatggtgctgatggtggagtgtccgatcatccttttgatattatttctagttttgttgacgattttgtagattcgaagaggaatttgttgagtcagg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23887502 |
gatgatggtgcggatggtggagtgtccgatcatccttttgatattatttctagttttgttgacgattttgtagattcgaagaggaatttgttgagtcagg |
23887601 |
T |
 |
| Q |
201 |
tttcgggatggctgcttagcgataagagagaagataaaatagatgattttgttcaggagatggaaatgaatggtttttggttgttagatagacgagaaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23887602 |
tttcgggatggctgcttagcgataagagagaagataaaatagatgattttgttcaggagatggaaatgaatggtttttggttgttagatagacgagaaaa |
23887701 |
T |
 |
| Q |
301 |
agttgctgaaaatttgcttaagaatgttgacttcaagaactcgtttcattgcagcgcgagttttgttaacaaagacgaacttgtcgcccatgttgataat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23887702 |
agttgctgaaaatttgcttaagaatgttgacttcaagaactcgtttcattgcagcgcgagttttgttaacaaagacgaacttgtcgcccatgttgataat |
23887801 |
T |
 |
| Q |
401 |
tgtaacttca |
410 |
Q |
| |
|
|||||||||| |
|
|
| T |
23887802 |
tgtaacttca |
23887811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University