View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18138_low_11 (Length: 348)
Name: NF18138_low_11
Description: NF18138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18138_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 4759938 - 4759684
Alignment:
| Q |
1 |
aggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4759938 |
aggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagattga |
4759839 |
T |
|
| Q |
101 |
aagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggcgtcgcaggtggttagtcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4759838 |
aagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggcgtcacaggtggttagtcac |
4759739 |
T |
|
| Q |
201 |
cggagagcagggttaacggcgttgatttacctagctgatggaacttacatgtaag |
255 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4759738 |
cggagagcagggttgacggcgttgatttacctagctgatggaacttacacgtaag |
4759684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 266 - 331
Target Start/End: Complemental strand, 4759655 - 4759593
Alignment:
| Q |
266 |
atcaagcagcctaacagcgaatttcacgcaccaccaggttcaaactcatgtcacaatatatgaaat |
331 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
4759655 |
atcaagcagcctaacagcgaatttcacgc---accaggttcaaactcgtctcacaatatatgaaat |
4759593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 42 - 171
Target Start/End: Complemental strand, 26982283 - 26982154
Alignment:
| Q |
42 |
gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataa |
141 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||| ||| |||||||| ||||| | | | |||| ||||||||||||| ||||||||||| | |
|
|
| T |
26982283 |
gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaagatattgagatgctggctaaacaagatgttaaggtcagaaagttgatga |
26982184 |
T |
|
| Q |
142 |
cagaacttggagtggtgccggttttggtat |
171 |
Q |
| |
|
| |||||| | |||||||| || ||||||| |
|
|
| T |
26982183 |
ctgaacttcgggtggtgcctgtattggtat |
26982154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 42 - 94
Target Start/End: Original strand, 26999135 - 26999187
Alignment:
| Q |
42 |
gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaaga |
94 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||| ||| |||||||| |
|
|
| T |
26999135 |
gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaaga |
26999187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University