View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18138_low_20 (Length: 243)
Name: NF18138_low_20
Description: NF18138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18138_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 46472664 - 46472455
Alignment:
| Q |
12 |
agagacaaggtgaaagatacggagatttgtgaagtgaaaaatagcaaagtttaagacaaaggttgcatagtatttggttccatactgcaaggtgaatgtc |
111 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46472664 |
agagacaaggtgaaagctatggagatttgtgaagtgaaaaatagcaaagtttaagacaaaggttgcatagtatttggttccatactgcaaggtgaatgtc |
46472565 |
T |
|
| Q |
112 |
tttatggatttgaaaatgtctgagacttcttacatagtaatatttaaacagtccaaggccaaagttgccgagttcatcaaactgatatcaagtaatattt |
211 |
Q |
| |
|
|||| | |||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46472564 |
tttaggaatttgaaaatgtctgaga---cttacaaagtaatatttaaacagtccaaggccaaagttgttgagttcatcaaactgatatcaagtaatattt |
46472468 |
T |
|
| Q |
212 |
gaatcctagttcc |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
46472467 |
gaatcctagttcc |
46472455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University