View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18138_low_21 (Length: 240)
Name: NF18138_low_21
Description: NF18138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18138_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 218
Target Start/End: Complemental strand, 38762204 - 38761995
Alignment:
| Q |
9 |
agcaaagggtgtgagaaaaatagtagctgcagattgtctgtagaaaacaaagacgaaattgttcatgccatggtcgaatgcagcttttgacagaagaaac |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762204 |
agcaaaaggtgtgagaaaaatagtagctgcagattgtctgtagaaaacaaagacgaaattgttcatgccatggtcgaatgcagcttttgacagaagaaac |
38762105 |
T |
 |
| Q |
109 |
atagcagcatatatggcttgtatgattaccacaaccaaatatggattgtttattttcatcttactagctgatttgcttttatgatcaatagatcacctaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762104 |
atagcagcatatatggcttgtatgattaccacaaccaaatatggattgtttcttttcatcttactagctgatttgcttttatgatcaatagatcacctaa |
38762005 |
T |
 |
| Q |
209 |
attatatata |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
38762004 |
attatatata |
38761995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 43620982 - 43620913
Alignment:
| Q |
42 |
ttgtctgtagaaaacaaagacgaaattgttcatgccatggtcgaatgcagcttttgacagaagaaacata |
111 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||| |||||||| || |||||||||||||| || ||||||||| |
|
|
| T |
43620982 |
ttgtctatagaacacaaagatgaaattgttgatgccatgatcaaatgcagcttttgagagtagaaacata |
43620913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University