View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18138_low_29 (Length: 227)
Name: NF18138_low_29
Description: NF18138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18138_low_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 51856041 - 51855815
Alignment:
| Q |
1 |
aatcaacatgttaattacatgtagtatatttttgtaacagtctttttcttagcatgcaaatattacattggaacagtctcnnnnnnnnnnnnccctcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
51856041 |
aatcaacatgttaattacatgtagtatatttttgtaacagtctttttcttagcatgcaaatattacattggaaaagtctctttttctttcttccctcaaa |
51855942 |
T |
 |
| Q |
101 |
gaagcattcgtccattcatgtagaaaccgcagaatgaaaagtttatatattgatcattatttcattttgaaaaagtactacaaattcagtaactatgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51855941 |
gaagcattcgtccattcatgtagaaaccgcagaatgaaaagtttatatattgatcattatttcattttgaaaaagtactacaaattcagtaactatgttg |
51855842 |
T |
 |
| Q |
201 |
aagtaagtaagcattcagtattggcac |
227 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
51855841 |
aagtaagcaagcattcagtattggcac |
51855815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University