View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18139_high_4 (Length: 204)
Name: NF18139_high_4
Description: NF18139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18139_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 44546426 - 44546253
Alignment:
| Q |
18 |
accatctgtgatctttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtgaa---gaaggttgtagagctttttcttttgagtattaggg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
44546426 |
accatctgtgatctttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtgaagaagaaggtcgtagagctttttcttttgagtattaggg |
44546327 |
T |
 |
| Q |
115 |
tacctaatcttgtgaagaagaaggaaatcatataaatctttttcatgatcccatgttctctttctagggttcatctc |
191 |
Q |
| |
|
| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44546326 |
tccctaatcttgt---gaagaaggaaatcatataaatctttttcatgatcccatgttctctttctagggttcttctc |
44546253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University