View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18139_low_3 (Length: 531)
Name: NF18139_low_3
Description: NF18139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18139_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 487; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 487; E-Value: 0
Query Start/End: Original strand, 1 - 519
Target Start/End: Complemental strand, 37965821 - 37965303
Alignment:
| Q |
1 |
attgtcgccatccgagacatccattatgacacccatctcaccgtcctcattctgatcctcattctgatcggctaacatagcggggtccatctcaggcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
37965821 |
attgtcgccatccgagacatccattatgacacccatctcagcatcctcattctgatcctcattctgatcggctaacatatcgggatccatctcaggcctc |
37965722 |
T |
|
| Q |
101 |
atccgtctactaaagctgctgagatcattcccctgccgaaccgcatgtaacaggaggaagaaattcatggcctccatacccatctcaaatctcccatttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37965721 |
atccgtctactaaagctgctgagatcattcccctgccgaaccgcatgtaacaggaggaagaaattcatagcctccatacccatctcaaatctcccatttc |
37965622 |
T |
|
| Q |
201 |
tttctgcattgcctgcttcatgagcaccctcctcatcatcggtatcgaagtcattattatggcgaccttctataacataatctccaaaaaccactgcccc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37965621 |
tttctgcattgcctgcttcatgagcaccctcctcatcatccgtatcgaagtcattattatggcgaccttctataacataatctccaaaaaccactgcccc |
37965522 |
T |
|
| Q |
301 |
cggtatggctgatgtcactgtgctgataacatcttctcgttcacgctcccactcgagccatctccatttctgctcatgatcaggatctactgtccttgga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37965521 |
cggtatggctgatgtcactgtgctgataacatcttctcgttcacgctcccactcaagccatctccatttctgctcatgatcaggatctactgtccttgga |
37965422 |
T |
|
| Q |
401 |
cgtgctgaaggatgctctgcccgcacatgcttcttcaactccttatagttaccgacaaatgagcagttatcctgcatgcaacttcttttcttttcgttga |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37965421 |
cgtgctgaaggatgctctgcccgcacatgcttcttcaactccttatagttaccgacaaacgagcagttatcctgcatgcaacttcttttcttttcgttga |
37965322 |
T |
|
| Q |
501 |
gaaagtctcgcacaggttc |
519 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37965321 |
gaaagtctcgcacaggttc |
37965303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University