View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18140_high_12 (Length: 348)
Name: NF18140_high_12
Description: NF18140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18140_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 76 - 224
Target Start/End: Complemental strand, 54478509 - 54478361
Alignment:
| Q |
76 |
ttatattgaagacaagcagatagcacttgtttggttctacgaggatgcagatcaagattttagacaaaaagccaagttaaagaacttttaaattctaatt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54478509 |
ttatattgaagacaagcagatagcacttgtttggttctacgaggatgcagatcaagatgttagacaaaaagccaagttaaagaacttttaaattctaatt |
54478410 |
T |
 |
| Q |
176 |
aacagttttcataactgcaactgctaattatttctactgatcaatcatt |
224 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54478409 |
aacagtcttcataactgcaactgctaattatttctactgatcaatcatt |
54478361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 16 - 85
Target Start/End: Complemental strand, 54478599 - 54478530
Alignment:
| Q |
16 |
tgtggacctgcaatagattgtagttaattggaaacaaattccaaatattatgatgaagctttatattgaa |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54478599 |
tgtggacctgcaatagattgtagttaattggaaacaaattccaaatattatgatgaagctttatattgaa |
54478530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 44590293 - 44590237
Alignment:
| Q |
80 |
attgaagacaagcagatagcacttgtttggttctacgaggatgcagatcaagatttt |
136 |
Q |
| |
|
|||||||| ||| ||| |||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
44590293 |
attgaagataaggagacagcacttgtttggtgctacgaggatgcagatccagatttt |
44590237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University