View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18140_high_22 (Length: 234)
Name: NF18140_high_22
Description: NF18140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18140_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 8931145 - 8931346
Alignment:
| Q |
1 |
agaattcacatagctcagagatgatatctaaggcacccatattttgttaaacaaaccaagaggacaatggttgctgaaattagattaagt---aataaac |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8931145 |
agaattcacatagctcagagatgatatctaaggcacccatattttgttaaacaaaccaagaggacaatggttgctgaaattagattaagtacaaataaac |
8931244 |
T |
|
| Q |
98 |
aatagagaaaaaagtacgtgtatataaatctatgcatgatggatttggcaatgcatgatcacattaatgaacttcttggcatggctttcgctagaaggtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931245 |
aatagagaaaaaagtacgtgtatataaaaat-----------------caatgcatgatcacattaatgaacttcttggcatggctttcgctagaaggtt |
8931327 |
T |
|
| Q |
198 |
ctacttgagcaatgagttg |
216 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8931328 |
ctacttgagcaatgagttg |
8931346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University