View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18140_high_23 (Length: 216)
Name: NF18140_high_23
Description: NF18140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18140_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 5475621 - 5475799
Alignment:
| Q |
19 |
caatatttataaattgtctatttttatattggttgtttatagttgttgaattttagatgttcaaataagattgnnnnnnncaaaaatatatttaacggta |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| || || |||| |
|
|
| T |
5475621 |
caatatttataaatcgtctatttttatattggttgtttatagttgttgatttttagatgttcaaataagattgttcttttcaaaaatatcttcaatggta |
5475720 |
T |
 |
| Q |
119 |
gttaactatttttcgttgctgaacaagagttaactaccgtttaatgcaaggtggtaaatgtgttcaaaagttgcaagcc |
197 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
5475721 |
gttaactatttttcgttgctgaacgagagttaactaccgtttagtgcaaggtggtaaatgcgttcaaatgttgcaagcc |
5475799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University