View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18140_low_21 (Length: 241)
Name: NF18140_low_21
Description: NF18140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18140_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 47 - 224
Target Start/End: Original strand, 2129544 - 2129733
Alignment:
| Q |
47 |
caaccaccattttcactctagcctccttccatgggaagatca------------aaaggtcgtagccgaggtcagcacatccgtgacagtgtccatggcg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2129544 |
caaccaccattttcactctagcctccttccatgggaagatcaggaggtcgtcgaaaaggtcgtagccgaggtcagcacatccgtgacagtgtccatggcg |
2129643 |
T |
|
| Q |
135 |
gaaaccccttgcccaccagttctctactaggcactgaaacgaaaaaattgcttcaaaactctatcactttttcatattataactcctttg |
224 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2129644 |
gaaacccctcgcccaccagttctctactaggcactgaaacgaaaaaattacttcaaaactctatcactttttcatattataactcctttg |
2129733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 47 - 89
Target Start/End: Original strand, 2111401 - 2111443
Alignment:
| Q |
47 |
caaccaccattttcactctagcctccttccatgggaagatcaa |
89 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2111401 |
caaccaccattttcactctaccctccctccatgggaagatcaa |
2111443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 161
Target Start/End: Original strand, 2111446 - 2111488
Alignment:
| Q |
119 |
gacagtgtccatggcggaaaccccttgcccaccagttctctac |
161 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
2111446 |
gacagtgtccatggcggaaacccatcgcccaccagttctctac |
2111488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 95 - 131
Target Start/End: Complemental strand, 14148361 - 14148325
Alignment:
| Q |
95 |
cgtagccgaggtcagcacatccgtgacagtgtccatg |
131 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14148361 |
cgtagccgaggtcagcacctccgtgacagtgtccatg |
14148325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University