View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18141_high_10 (Length: 208)
Name: NF18141_high_10
Description: NF18141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18141_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 31870908 - 31870733
Alignment:
| Q |
14 |
cacagatcgccgcagaagatatcctcatcaaaatccccggcgccattcttcaccttattgatcaacaatacagcttcgaacttgctatcggtgatctcac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31870908 |
cacagatcgccgcagaagatatcctcatcaaaatccccggcgccattcttcaccttattgatcaacaatacagcttcgaacttgctatcagtgatctcac |
31870809 |
T |
 |
| Q |
114 |
catcattcgtctccggcaggggaataacaccgtagctgtttacgctcgtgtcggcaatgagattcaatggccgctt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870808 |
catcattcgtctccggcaggggaataacaccgtagctgtttacgctcgtgtcggcaatgagattcaatggccgctt |
31870733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 128
Target Start/End: Original strand, 8850963 - 8851051
Alignment:
| Q |
40 |
atcaaaatccccggcgccattcttcaccttattgatcaacaatacagcttcgaacttgctatcggtgatctcaccatcattcgtctccg |
128 |
Q |
| |
|
|||||||||||||| |||||||| |||| || ||||||||||||||| | ||||||||| |||||| ||||| || | |||||||| |
|
|
| T |
8850963 |
atcaaaatccccggagccattctcaacctcatcgatcaacaatacagcgttgaacttgcttccggtgacttcaccgtcgtccgtctccg |
8851051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University