View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18141_high_7 (Length: 269)
Name: NF18141_high_7
Description: NF18141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18141_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 21 - 188
Target Start/End: Original strand, 32535626 - 32535792
Alignment:
| Q |
21 |
tagaatccaatccaactccaagccattttcacattgtccagaaaaactatatcactatttaaaatgggtgaaccaaatgagagcacataaatgatcatat |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32535626 |
tagaatccaatccaactccaagccgttttcacattgtccagaaaaactatatcactatttaaaatgggtgaaccaaatgagagcacataaatgatcatat |
32535725 |
T |
|
| Q |
121 |
atactttcaatccgaatcacatgaatggggatcatatactaaaatggataaaatctatctgtgtgtga |
188 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32535726 |
ttactttcaatccgaatcacatgaat-gggatcatatactaaaatagataaaatctatctgtgtgtga |
32535792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 214 - 254
Target Start/End: Original strand, 32535818 - 32535858
Alignment:
| Q |
214 |
cttccaatttcttgtggacaaatctccaaaattacaaaaac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32535818 |
cttccaatttcttgtggacaaatctccaaaattacaaaaac |
32535858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University