View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18141_low_4 (Length: 392)
Name: NF18141_low_4
Description: NF18141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18141_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 10 - 374
Target Start/End: Complemental strand, 48767368 - 48766991
Alignment:
| Q |
10 |
aagaatatacaggaaacagatcaaaactcgtcatgatcctgttaaatagagttgttgtatcagtatcacatacataatttgtagctaggaaaaatttgta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767368 |
aagaatatacaggaaacagatcaaaactcgtcatgatcctgttaaatagagttgttgtatcagtatcacatacataatttgtagctaggaaaaatttgta |
48767269 |
T |
 |
| Q |
110 |
gctagtaattattactgctacatctaaacatggttccttgtcgtcatttgttgttcttagggttagttattttagtctaacgcaatataaacttaattat |
209 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48767268 |
gctagtaattactactgctacatctaaacatggttccttgtcgtcatttgttgttcttagggttagttattttagtctaacgcaatataaactgaattat |
48767169 |
T |
 |
| Q |
210 |
ggcttgtatatgagtaattatgagaaat-------------tatgttcacttgcaaattgcaactttaaaccgatcaacacaattatgtgccgaaacttg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767168 |
ggcttgtatatgagtaattatgagaaatatgcattgatgtatttgttcacttgcaaattgcaactttaaaccgatcaacacaattatgtgccgaaacttg |
48767069 |
T |
 |
| Q |
297 |
tcatgaacaaaggttcggattggtaaaaagtagctgatgatagataaactctattaagaatgtgttgcttaacatttt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48767068 |
tcatgaacaaaggttcggattggtaaaaagtagcggatgatagataaactctattaagaatgtgttgcttaacatttt |
48766991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University