View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18141_low_8 (Length: 268)
Name: NF18141_low_8
Description: NF18141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18141_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 40231345 - 40231609
Alignment:
| Q |
1 |
tggtttttagtttagattactacnnnnnnncaatagtagattcatagttttcctaaatgaaatgattggttcagatgtattggtgtgtgtcaatgtcttg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40231345 |
tggtttttagtttagattactactttttttcaatagtagattcatagttttcctaaatgaaatgattggttcagatgtattggtgtgtgtcaatgtcttg |
40231444 |
T |
|
| Q |
101 |
tattggtttatttgtgaaatagaactttttgtagctcttcactgcaaatttactgtaactgtaacttagaacaaggcttgcttctaatttgtaatttaga |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40231445 |
tgttggtttatttgtgaaatagaactttttgtagctcttcactgcaaatttactgtaactgtaacttagaacaaggcttgcttctaatttgtaatttaga |
40231544 |
T |
|
| Q |
201 |
accctcagattaattttgtttattaactctgtttcatcttcactgcaaatttactgatgatgtcc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40231545 |
accctcagattaattttgtttattaactctgtttcatcttcactgcaaatttactgatgatgtcc |
40231609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 186 - 265
Target Start/End: Original strand, 24679343 - 24679422
Alignment:
| Q |
186 |
aatttgtaatttagaaccctcagattaattttgtttattaactctgtttcatcttcactgcaaatttactgatgatgtcc |
265 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| || ||||||| | ||||||||| |
|
|
| T |
24679343 |
aatttgtaatttagaaccctaagattaattttgtttattaactctgtttcatcgtcattgtaaatttaataatgatgtcc |
24679422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 58 - 127
Target Start/End: Original strand, 24653121 - 24653190
Alignment:
| Q |
58 |
tgaaatgattggttcagatgtattggtgtgtgtcaatgtcttgtattggtttatttgtgaaatagaactt |
127 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24653121 |
tgaaatgattggttaagctgtattggtgtgtgttaatgtcttgtattggttcatttgtgaaatagaactt |
24653190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 49 - 126
Target Start/End: Original strand, 24679210 - 24679287
Alignment:
| Q |
49 |
tttcctaaatgaaatgattggttcagatgtattggtgtgtgtcaatgtcttgtattggtttatttgtgaaatagaact |
126 |
Q |
| |
|
||||| || |||||||||||||| || ||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
24679210 |
tttccgaactgaaatgattggttaagctgtattggtgtgtgttaatgtcttgtattggtacatttgtgaaatagaact |
24679287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 105
Target Start/End: Original strand, 19899573 - 19899637
Alignment:
| Q |
41 |
ttcatagttttcctaaatgaaatgattggttcagatgtattggtgtgtgtcaatgtcttgtattg |
105 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| | || || | ||||| |||||||||||||| |
|
|
| T |
19899573 |
ttcataattttcctaaatgaaacgattggttcagctttagtgatttgtgttaatgtcttgtattg |
19899637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University