View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18142_low_11 (Length: 239)
Name: NF18142_low_11
Description: NF18142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18142_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 221
Target Start/End: Complemental strand, 21444689 - 21444472
Alignment:
| Q |
4 |
aaaatttagatcatctaatcttaatcggactactgaaatacgcgtaactacggtactcaatccaaatcctttccacatcccatcttacattttttcggat |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
21444689 |
aaaatttggatcatctaatcttaatcggactactgaaatacgcgtaactacggtactcaatccaaatcctttccacataccatcttacatttttttggat |
21444590 |
T |
 |
| Q |
104 |
tgaagagggccaacgcccatatacaccatcttacatttagtatattatgaaattggtacttggtttttagattaatcataatcttctcactcatgcacat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21444589 |
tgaagagggccaacgcccatatacaccatcttacatttagcatattatgaaattggtaattggtttttagattaatcataatcttctcactcatgcacat |
21444490 |
T |
 |
| Q |
204 |
tcttctattactaactag |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
21444489 |
tcttctattactaactag |
21444472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University